Journal: Cellular and Molecular Life Sciences

Article Title: DNA barcoding and gene expression recording reveal the presence of cancer cells with unique properties during tumor progression

doi: 10.1007/s00018-022-04640-4

Figure Lengend Snippet: Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , POU5F1 , and SOX2 . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)

Article Snippet: pX330 (Addgene) was treated with BbsI (New England Biolabs), and DNA oligonucleotides comprising a gRNA sequence targeting the 3′ untranslated region (NANOG and SOX2) or downstream of the gene (POU5F1) were inserted into the BbsI site (NANOG: CCCATCCCTCATAGGATTTT, SOX2: GTACTGGCGAACCATCTCTG, and POU5F1: TTAAGGTCACACAACATCAG).

Techniques: Expressing, Sequencing, Flow Cytometry, Western Blot

Journal: Cellular and Molecular Life Sciences

Article Title: DNA barcoding and gene expression recording reveal the presence of cancer cells with unique properties during tumor progression

doi: 10.1007/s00018-022-04640-4

Figure Lengend Snippet: Tracing a progeny of cells expressing stem cell transcription factors, including NANOG, POU5F1, and SOX2, in anticancer drug treatment or sphere formation. A – C Line plot depicting the percent mutation in stgRNA on days 0, 7, and 14 in NANOG-DU145 ( A ), POU5F1-DU145 ( B ), and SOX2-DU145 ( C ) cells. P value was calculated using Welch’s t -test with Bonferroni adjustment ( n = 3). D – F Heatmap representing the average score in each cell of top 10 cells with a high number of mutated reads from each sample in NANOG-DU145 ( n = 196 for #112; n = 176 for #128) ( D ), POU5F1-DU145 ( n = 195 for #112; n = 203 for # 114) ( E ), and SOX2-DU145 ( n = 152 for #98; n = 198 for #101) ( F ) cells. G Schema of the composition of cancer cells during tumor progression. H Schema of method- and cell-type-dependent variations in lung metastasis formation. I Schema of the lineage-specific or -stochastic expression of transcription factors. NT non-treatment, DTX docetaxel treatment; and Sphere sphere formation

Article Snippet: pX330 (Addgene) was treated with BbsI (New England Biolabs), and DNA oligonucleotides comprising a gRNA sequence targeting the 3′ untranslated region (NANOG and SOX2) or downstream of the gene (POU5F1) were inserted into the BbsI site (NANOG: CCCATCCCTCATAGGATTTT, SOX2: GTACTGGCGAACCATCTCTG, and POU5F1: TTAAGGTCACACAACATCAG).

Techniques: Expressing, Mutagenesis

Journal: Stem Cell Reports

Article Title: piggyBac Insertional Mutagenesis Screen Identifies a Role for Nuclear RHOA in Human ES Cell Differentiation

doi: 10.1016/j.stemcr.2015.03.001

Figure Lengend Snippet: PB Mutagenesis in OCT4 Reporter Human ES Cells (A) Splicing consequences of PB[ I nsertional Mutagenesis,NANOG] (PB[IM,N]) insertion either in front of or within the intron of a gene. PB[IM,N] insertion into any reading frame is capable of inducing both overexpression of the downstream transcript with the β actin promoter and triple reading frame start cassette (not shown) as well as simultaneous expression of Katushka fluorescent marker by the splicing of Katushka/IRES into the native transcript with the splice donor (SD). This construct is also able to create N-terminally truncated transcripts with the splice acceptor, triple reading frame stop cassette, and poly A tail (SA-stop-pA). PB[IM,N] can also constitutively overexpress NANOG transcript from the independent NANOG overexpression cassette. (B) (Top) FACS analysis of Katushka expression from PB[IM,N] in human ES cells 48 hr after transfection in single-cell suspension using the RFP channel. Mean of triplicate independent experiments is shown. Error bars represent SD. (Bottom) PB copy number within ten individual PB[IM,N] transfected human ES cell clones as assessed by real time PCR. There is a mean of five PB[IM,N] insertions per clone. (C) Protocol of screen performed in H1 OCT4 -EGFP cells for resistance to RA-induced differentiation using PB[IM,N]. Cells in six-well plates were transfected with PB[IM]N, puromycin selected, and subsequently treated with RA and G418. Cells were then split from the six-well plates into 10-cm plates at a 2:1 ratio and maintained on G418 alone. (D) Brightfield and fluorescent images of the six unique clones recovered from the screen. All clones are positive for EGFP and Katushka fluorescent reporters for OCT4 expression and PB[IM,N] insertion within an actively expressed gene.

Article Snippet: The H1 OCT4 -EGFP human ES cell line was created in the James Thomson laboratory and obtained from the WiCell Research Institute under the appropriate material transfer agreement (MTA).

Techniques: Mutagenesis, Over Expression, Expressing, Marker, Construct, Transfection, Clone Assay, Real-time Polymerase Chain Reaction

Journal: Stem Cell Reports

Article Title: piggyBac Insertional Mutagenesis Screen Identifies a Role for Nuclear RHOA in Human ES Cell Differentiation

doi: 10.1016/j.stemcr.2015.03.001

Figure Lengend Snippet: NANOG Expression from PB Constructs Induces Resistance to RA-Induced Differentiation (A) OCT4 immunostaining in WT and NANOG expressing human ES cells. NANOG expressing cells resist spontaneous differentiation and maintain OCT4 signal in colony centers at larger diameters than WT cells. Scale bar represents 100 μm. (B) (Top) Morphology of RA differentiated cells. The red square highlights a cluster of morphologically undifferentiated NANOG expressing cells after RA treatment, magnified in inset. Scale bar represents 200 μm. (Bottom) RT-PCR analysis of RA-differentiated cells. (C) Immunostaining of RA-differentiated cells co-stained for NANOG and GATA6. RA induces differentiation of human ES cells as assessed by GATA6 endoderm marker. Scale bar represents 150 μm. (D) Real-time PCR (top) and western blot (bottom) analysis of stemness marker expression in RA-treated cells. The addition of a NANOG overexpression cassette to PB[IM] induces protein overexpression of both NANOG and the NANOG target OCT4 and induces weak persistence of NANOG and OCT4 after RA treatment. Graph shows mean of triplicate independent experiments. Error bars represent SD. ∗∗ p < 0.001 in Student’s t test. (E) Alkaline phosphatase staining of combined RA/G418-treated cells after 16 days. Experiments are performed in duplicate. A representative plate is shown.

Article Snippet: The H1 OCT4 -EGFP human ES cell line was created in the James Thomson laboratory and obtained from the WiCell Research Institute under the appropriate material transfer agreement (MTA).

Techniques: Expressing, Construct, Immunostaining, Reverse Transcription Polymerase Chain Reaction, Staining, Marker, Real-time Polymerase Chain Reaction, Western Blot, Over Expression

Journal: Stem Cell Reports

Article Title: piggyBac Insertional Mutagenesis Screen Identifies a Role for Nuclear RHOA in Human ES Cell Differentiation

doi: 10.1016/j.stemcr.2015.03.001

Figure Lengend Snippet: PB Mutagenesis of DENND2C Causes Morphological Changes and Resistance to RA (A) (Top) Screenshot from the UCSC Genome Browser detailing the position and orientation of the PB[IM,N] insertion in DENND2C mapped in clone 2 (red arrow). (Bottom right) PB[IM,N] insertion results in overexpression of the C-terminal half of DENND2C, made up primarily of its DENN domain. (Bottom left) The C terminus of DENND2C is significantly upregulated in clone 2 by real-time PCR. Graph shows mean of triplicate technical replicates, and error bars represent SD. ∗∗ p < 0.001 in Student’s t test. (B) Brightfield and OCT4 -EGFP reporter images of clone 2 and DENND2C expressing human ES cells. Clone 2 aggregates into either balls of cells or flat, extremely dense colonies that resist spontaneous differentiation. Cells stably transfected with full-length (FL) or truncated (TR) DENND2C also display this behavior. Scale bar represents 50 μm. (C) RT-PCR showing maintenance of stemness in DENND2C expressing human ES cells, which do not display markers of differentiation. (D) Western blot demonstrating that DENND2C overexpressing cells produce NANOG and OCT4 proteins at levels comparable to the parental WT and NANOG overexpressing cell lines. Overexpressed DENND2C-FL runs as a doublet, while only DENND2C-TR lysate exhibits a band running at the predicted 50 kDa of truncated DENND2C. (E) Alkaline phosphatase-stained plates after RA/G418 treatment. Experiments were performed in triplicate. A representative plate for each set of experiments is shown. See Figure S1 for additional information.

Article Snippet: The H1 OCT4 -EGFP human ES cell line was created in the James Thomson laboratory and obtained from the WiCell Research Institute under the appropriate material transfer agreement (MTA).

Techniques: Mutagenesis, Over Expression, Real-time Polymerase Chain Reaction, Expressing, Stable Transfection, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot, Staining

Journal: Stem Cell Reports

Article Title: piggyBac Insertional Mutagenesis Screen Identifies a Role for Nuclear RHOA in Human ES Cell Differentiation

doi: 10.1016/j.stemcr.2015.03.001

Figure Lengend Snippet: DENND2C Phenotype Is Induced by Loss of Active RHOA and RAC1 (A) DAPI and F-actin immunostaining of WT and DENND2C expressing human ES cells. Scale bar represents 30 μm. (B) Brightfield and OCT4 -EGFP reporter images of cells stably expressing dominant-negative RHOA T19N (RHOA DN) and dominant-negative RAC1 T17N (RAC1 DN). Scale bar represents 50 μm. (C) DAPI and F-actin immunostaining of WT and RHOA DN and RAC1 DN mutant human ES cells. Scale bar represents 30 μm. (D) Plates stained for alkaline phosphatase after RA/G418 treatment. Experiments were performed in triplicate. A representative plate for each set of experiments is shown. (E) The induction of lineage markers with RA assessed by real-time PCR. RA treatment induces differentiation as reflected by the induction of the endoderm marker GATA6. NANOG expression from PB induces some repression of GATA6 and no upregulation of endogenous NANOG. NANOG/DENND2C and NANOG/RHOA DN cells display enhanced repression of GATA6 and upregulation of endogenous NANOG at the RNA level. Graph shows mean of triplicate independent experiments. Error bars represent SD. ∗∗ p < 0.001, ∗ p < 0.05 in Student’s t test. (F) Immunoprecipitation of active RHOA and RAC1 in DENND2C expressing cells. DENND2C expressing cells have decreased active RHOA and RAC1 relative to WT cells. See Figure S2 for additional information.

Article Snippet: The H1 OCT4 -EGFP human ES cell line was created in the James Thomson laboratory and obtained from the WiCell Research Institute under the appropriate material transfer agreement (MTA).

Techniques: Immunostaining, Expressing, Stable Transfection, Dominant Negative Mutation, Mutagenesis, Staining, Real-time Polymerase Chain Reaction, Marker, Immunoprecipitation

Journal: Stem Cell Reports

Article Title: piggyBac Insertional Mutagenesis Screen Identifies a Role for Nuclear RHOA in Human ES Cell Differentiation

doi: 10.1016/j.stemcr.2015.03.001

Figure Lengend Snippet: DENND2C Negatively Regulates Nuclear RHOA Activities (A) DAPI and RHOA immunostaining of WT and DENND2C expressing ES cell colonies. Scale bar represents 10 μm. (B) DAPI and RHOA immunostaining of isolated WT and DENND2C expressing nuclei. Scale bar represents 3 μm. (C) Immunoprecipitation of active RHOA from nuclear and cytoplasmic fractions of WT and mutant cells. DENND2C and RHOA DN cells have reduced active RHOA in both nuclear and cytoplasmic fractions. Cytoplasmic RHOA inhibitor (RAB35) is included as a negative control. (D) ChIPs performed in human ES cells with a RHOA monoclonal antibody and NANOG-positive control antibody. Presented is the average fold enrichment over IgG control of the OCT4 promoter, GATA6 promoter, chromosome 13 gene desert, and α satellite DNA. Error bars represent the mean percent fold enrichment over IgG control ± the SEM for triplicate technical replicates. See Figure S3 for additional information.

Article Snippet: The H1 OCT4 -EGFP human ES cell line was created in the James Thomson laboratory and obtained from the WiCell Research Institute under the appropriate material transfer agreement (MTA).

Techniques: Immunostaining, Expressing, Isolation, Immunoprecipitation, Mutagenesis, Negative Control, Positive Control

Journal: Nature Neuroscience

Article Title: Exome sequencing of individuals with Huntington’s disease implicates FAN1 nuclease activity in slowing CAG expansion and disease onset

doi: 10.1038/s41593-022-01033-5

Figure Lengend Snippet: a , Schematic depicting CRISPR-Cas9 targeting of exon 2 of FAN1 in Q109-n1 and Q109-n5 using two guide RNAs (gRNAs) to induce a 94 bp deletion leading to a premature stop codon and FAN1 knockout. The primer pair used for PCR screening of exon 2 after CRISPR is also shown. b , Diagnostic PCR screen using primers FAN1-KO-F and FAN1-KO-R showing representative banding patterns for iPSC lines with the three possible FAN1 genotypes after CRISPR: FAN1 +/+ (230/230 bp; wild-type), FAN1 +/− (230/135 bp) and FAN1 −/− (135/135 bp). c , Sanger sequencing of PCR products demonstrates the targeted 94 bp deletion in exon 2 of FAN1. d , Undifferentiated iPSCs stained for the pluripotency marker OCT4. iPSC-derived neurons stained positive for the neuronal marker MAP2 (red) and CTIP2 (green). All nuclei are counterstained with DAPI (blue). e , Schematic depicting CRISPR-Cas9 targeting of exon 13 of FAN1 in Q109-n5 using a homology directed repair (HDR) template. A single guide RNA sequence (grey) and a 122 bp HDR template containing the desired gene edit coding for an amino acid change (D960A) were utilised to generate FAN1-nuclease dead clones. The HDR template contained two silent mutations (lowercase) to prevent Cas9 re-cutting of the edited region and to introduce a StuI restriction site for diagnostic screening. f , Restriction digest with StuI confirms Q109-n5 FAN1 +/+ , Q109-n5 FAN1 + /D960A and Q109-n5 FAN1 D960A/D960A genotypes. StuI cleaves the 442 bp PCR product into 124 and 318 bp products only in the presence of the silent 2868 G > A mutation. The parental Q109-n5 line is also shown as a negative control (right). g , Sanger sequencing of PCR products confirms successful introduction of D960A variant. h , Virtual karyotyping of iPSC lines using copy number variant (CNV) analysis at the time of repeat expansion experiments. CNV analysis reveals small deletions at 2q22.1 and 14q24.3 and duplications at 12q14.2 in all samples. Duplication of chromosome 1 shown in all but one sample.

Article Snippet: Primary antibodies used were OCT4 (Abcam, ab19857, 1:100), CTIP2 (Abcam, ab18465, 1:200) and MAP2 (Abcam, ab32454, 1:500).

Techniques: CRISPR, Knock-Out, Diagnostic Assay, Sequencing, Staining, Marker, Derivative Assay, Clone Assay, Introduce, Mutagenesis, Negative Control, Variant Assay

Journal: Acta Pharmaceutica Sinica. B

Article Title: Targeting stem-property and vasculogenic mimicry for sensitizing paclitaxel therapy of triple-negative breast cancer by biomimetic codelivery

doi: 10.1016/j.apsb.2025.04.006

Figure Lengend Snippet: Regulation of the stem-property in 4T1 cells. (A) Transwell analysis in 4T1 cells, scale bars = 200 μm; (B, C) The representative images of scratch assay in 4T1 cells and the statistical analysis of wound area, scale bar = 100 μm; (D) Representative images of the 4T1 tumorspheres on Day 12 after different treatments, scale bar = 50 μm; (E, F) The statistical analysis of number and diameter of tumorspheres; (G) Schematic mechanism of SHK inhibiting stem-property of 4T1 cells; (H) Western blot analysis of PKM2, β -Catenin, epithelial or mesenchymal markers, stem-property markers in 4T1 cells; Quantization of Western blot analysis (I) and the mRNA levels (J) of β- catenin, Pkm2, Vimentin, Oct4, Sox2, Nanog and E-cadherin in 4T1 cells; (K, L) The population of CD44 + /CD24 ‒ subtype in drug treated 4T1 cells and statistical analysis. Data are presented as mean ± SD ( n = 3). ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001, ns, not significant.

Article Snippet: PKM2 antibody, SOX2 antibody, OCT4 antibody, vimentin antibody, E-cadherin antibody, β -tubulin antibody, CDH5 antibody were purchased from Abmart (Shanghai, China). β -Catenin antibody, GAPDH antibody were purchased from Abcam (Cambridge, UK).

Techniques: Wound Healing Assay, Western Blot

Journal: Acta Pharmaceutica Sinica. B

Article Title: Targeting stem-property and vasculogenic mimicry for sensitizing paclitaxel therapy of triple-negative breast cancer by biomimetic codelivery

doi: 10.1016/j.apsb.2025.04.006

Figure Lengend Snippet: In vivo therapeutic efficacy of nanoparticles in a mouse model with lung metastasis of orthotopic BC. (A) Therapeutic schedule; (B) The tumor volume variations and (C) tumor weight; (D, E) The image of lung nodules of groups and the statistical analysis; (F) Representative H&E staining images of the lungs after different treatments (The area circled by the red line represents breast cancer lung metastasis nodules), scale bar = 50 μm; (G) Western blot analysis and quantization of β -Catenin, PKM2, OCT4, SOX2, NANOG, CDH5, VEGFA, Vimentin and E-Cadherin in tumor tissues; (H) Representative CD31/PAS staining of tumor tissue after different treatments. CD31 + represents vascular endothelial cell tube formation. CD31 ‒ /PAS + represents vasculogenic mimicry, scale bar = 50 μm. Data are presented as mean ± SD ( n = 3–6). ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001.

Article Snippet: PKM2 antibody, SOX2 antibody, OCT4 antibody, vimentin antibody, E-cadherin antibody, β -tubulin antibody, CDH5 antibody were purchased from Abmart (Shanghai, China). β -Catenin antibody, GAPDH antibody were purchased from Abcam (Cambridge, UK).

Techniques: In Vivo, Drug discovery, Staining, Western Blot

Journal: Stem Cell Research

Article Title: Derivation of human induced pluripotent stem cell line EURACi004-A from skin fibroblasts of a patient with Arrhythmogenic Cardiomyopathy carrying the heterozygous PKP2 mutation c.2569_3018del50

doi: 10.1016/j.scr.2018.09.003

Figure Lengend Snippet: Reagents details.

Article Snippet: Pluripotency Markers (Immunocytochemistry) , Rabbit anti-OCT4 , 1:100 , Thermo Fisher Scientific Cat# A24867, RRID: AB_2650999.

Techniques: Immunocytochemistry, Flow Cytometry, Control

Journal: Stem Cells International

Article Title: DNA Methylation Is Involved in the Expression of miR-142-3p in Fibroblasts and Induced Pluripotent Stem Cells

doi: 10.1155/2014/101349

Figure Lengend Snippet: Expression of miR-142-3p was regulated by DNA methylation. (a) Left panel shows schematic representation of luciferase constructs. Luciferase analysis using plasmids containing indicated length fragments of the 5′ upstream region of miR-142-3p-luciferase was done. Plasmid was transfected into 3T3 cells, and, after 6 hours, samples were treated with DMSO or 5-aza-dC (10 μ M) and cultured for additional 3 days. Then cells were harvested, and luciferase activities were examined. Values are average of 3 times independent experiments with standard deviation. P value, ∗∗ < 0.01 and n.s. > 0.05, was calculated by Student's t -test. (b–g) CpG methylation of 5′ upstream region of miR-142-3p was examined by bisulfite conversions. Genomic DNAs extracted from 3T3, MEF in the presence or absence of 5-aza-dC, iPS, or EB prepared from iPS were subjected to bisulfite sequence. 5-Aza-dC was present in the culture medium of 3T3 or MEF 72 hours before harvesting cells for genomic DNA extraction (e, f). (h) 3T3 cells were transfected with expression plasmid of Oct4, Sox2, Klf4, or Myc with −540 Luc. For control sample, empty expression plasmid and −540 Luc were transfected. Cells were harvested after 3 days of culture, and luciferase analysis was conducted. (i) 3T3 cells were transfected with indicated expression plasmid, and, after 3 days, cells were harvested, and total RNA was extracted. Expression level of endogenous miR-142-3p was examined by RT-qPCR. (h, i) Values are relative to control vector transfected samples and average of 4 independent samples with SD.

Article Snippet: Expression plasmids for mouse Oct4, Sox2, Klf, and Myc were purchased from AddGene.

Techniques: Expressing, DNA Methylation Assay, Luciferase, Construct, Plasmid Preparation, Transfection, Cell Culture, Standard Deviation, CpG Methylation Assay, Sequencing, DNA Extraction, Control, Quantitative RT-PCR